Review



px330 bbsi pitch addgene 127875 121  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc px330 bbsi pitch addgene 127875 121
    Px330 Bbsi Pitch Addgene 127875 121, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px330+bbsi+pitch/pX330-BbsI-PITCh+(Plasmid+%23127875)/pm41904131-261-40-41
    Average 93 stars, based on 68 article reviews
    px330 bbsi pitch addgene 127875 121 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: SMG1:SMG8:SMG9-complex integrity maintains robustness of nonsense-mediated mRNA decay
    Article Snippet: .. The plasmid px330- BbsI-PITCh UPF1 N is based on pX330-BbsI-PITCh (Addgene plasmid #127875; was a gift from Peter Kaiser) and encodes the UPF1 specific sgRNA (5’-CCCGTACGCCTCCACGCTCA-3’). .. The donor plasmid pCRIS-PITChv2-PurR-FLAG is based on pCRIS-PITChv2-dTAG-Puro (BRD4) (Addgene plasmid #91796; was a gift from James Bradner & Behnam Nabet) and contains two 40 bp-long N-terminal UPF1 microhomologies (5’-GCAGCGCGGAACCGGCCCGA GGGCCCTACCCGGAGGCACC-3’ and 5’-GAGCGT GGAGGCGTACGGGCCCAGCTCGCAGACTCTCAC TT-3’) flanking a Hygromycin resistance gene, a T2A signal, the FLAG-tag, and a linker region.

    Article Title: Rapid UPF1 depletion illuminates the temporal dynamics of the NMD-regulated transcriptome in human cells
    Article Snippet: .. For FKBP12F36V-tagging of UPF1, the knock-ins were performed using the CRIS-PITCh v2 system consisting of a pX330-BbsI-PITCh encoding the gene specific sgRNA (5′-CCCGTACGCCTCCACGCTCA-3′) and the pCRIS-PITChv2-PurR-FKBP (UPF1 N) donor plasmid (based on Addgene # 91796). pX330-BbsI-PITCh was a gift from Peter Kaiser (Addgene plasmid # 127875 ; http://n2t.net/addgene:127875 ; RRID:Addgene_-127875) and pCRIS-PITChv2-dTAG-Puro (BRD4) was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91796 ; http://n2t.net/addgene:91796 ; RRID:Addgene_91796). ..

    Article Title: Rapid UPF1 depletion illuminates the temporal dynamics of the NMD-regulated human transcriptome.
    Article Snippet: .. Knock-in cells using CRIS-PITCh v2 For FKBP12F36V-tagging of UPF1, the knock-ins were performed using the CRIS-PITCh v2 system189 consisting of a pX330-BbsIPITCh encoding the gene specific sgRNA (5′-CCCGTACGCCTCCACGCTCA-3′) and the pCRIS-PITChv2-PurR-FKBP (UPF1 N) donor plasmid (based on Addgene #91796). pX330-BbsI-PITCh was a gift from Peter Kaiser (Addgene plasmid # 127875; http:// n2t.net/addgene:127875; RRID:Addgene_127875) and pCRIS-PITChv2-dTAG-Puro (BRD4) was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91796; http://n2t.net/addgene:91796; RRID:Addgene_91796). ..

    Article Title: SMG1:SMG8:SMG9-complex integrity supports efficient execution of nonsense-mediated mRNA decay
    Article Snippet: .. The plasmid pX330-PITCh_SMG8 is based on pX330-BbsI-PITCh (Addgene plasmid # 127875; was a gift from Peter Kaiser) and contains the SMG8 sgRNA (5′- AGCTTGCGAGACCTTCTAAT -3′); the plasmid pX330-BbsI-PITCh-SMG9 contains the SMG9 sgRNA (5′-CGCTCTATCCCATAGAGTCC-3′), respectively. .. The donor plasmid pCRIS-PITChv2-SMG8_PurR_KO is based on pCRIS-PITChv2-dTAG-Puro (BRD4) (Addgene plasmid # 91796; was a gift from James Bradner & Behnam Nabet) and contains two 40 bp-long microhomologies (5′-CTGCACTATGGCTGGTCCCGTGAGCTTGCGAGA CCTTCTA-3′ and 5′-GGAGCATCAGCCTGGATGGGCTCT GAAAGTCCCGGAGGGT-3′) flanking a P2A signal, a puromycin resistance gene, a stop codon, and a poly(A) signal.

    Article Title: Zinc-finger proteins with a co-opted capsid domain anchor nucleosomes over transposon sequences
    Article Snippet: To establish a HAP1 cell line with its endogenous ZNF24 gene tagged with an FKBP12 F36V degron, the cells were first sorted based on cellular sizes with FACSAria II (BD Biosciences) to enrich for haploid cells as previously described ( ). .. The repair template plasmid construction and sgRNA cloning were performed as previously described ( , ). pCRIS-PITChv2-BSD-dTAG (BRD4) was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91792 ; http://n2t.net/addgene:91792 ; RRID:Addgene_91792) and pX330-BbsI-PITCh was a gift from Peter Kaiser (Addgene plasmid # 127875 ; http://n2t.net/addgene:127875 ; RRID:Addgene_127875). .. The constructed pCRIS-PITChv2-BSD-dTAG (ZNF24) and pX330-BbsI-PITCh (ZNF24) were transfected to the sorted HAP1 cells with TransIT-LT1 (Mirus Bio, MIR 2306).

    Knock-In:

    Article Title: Rapid UPF1 depletion illuminates the temporal dynamics of the NMD-regulated human transcriptome.
    Article Snippet: .. Knock-in cells using CRIS-PITCh v2 For FKBP12F36V-tagging of UPF1, the knock-ins were performed using the CRIS-PITCh v2 system189 consisting of a pX330-BbsIPITCh encoding the gene specific sgRNA (5′-CCCGTACGCCTCCACGCTCA-3′) and the pCRIS-PITChv2-PurR-FKBP (UPF1 N) donor plasmid (based on Addgene #91796). pX330-BbsI-PITCh was a gift from Peter Kaiser (Addgene plasmid # 127875; http:// n2t.net/addgene:127875; RRID:Addgene_127875) and pCRIS-PITChv2-dTAG-Puro (BRD4) was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91796; http://n2t.net/addgene:91796; RRID:Addgene_91796). ..

    Generated:

    Article Title: Loss of CFIm activates YAP/TAZ and connects mRNA cleavage and polyadenylation inhibition to BRCAness
    Article Snippet: .. PITCh dTAG donor vectors for NUDT21 targeting were generated by insertion of custom guide RNA sequences using the following plasmids: pX330-BbsI-PITCh (Addgene, 127875), pCRIS-PITChv2-BSD-dTAG (BRD4) (Addgene, 91792), pCRIS-PITChv2-Puro-dTAG (BRD4) (Addgene, 91793). .. The following plasmids were obtained from Addgene and were used without modification: a lentiviral vector encoding doxycycline-inducible YAP1-S127/397A (Addgene, 213585), NEDD4 and NEDD4L expression plasmids (Addgene, 27002 & 27000).

    Cloning:

    Article Title: Zinc-finger proteins with a co-opted capsid domain anchor nucleosomes over transposon sequences
    Article Snippet: To establish a HAP1 cell line with its endogenous ZNF24 gene tagged with an FKBP12 F36V degron, the cells were first sorted based on cellular sizes with FACSAria II (BD Biosciences) to enrich for haploid cells as previously described ( ). .. The repair template plasmid construction and sgRNA cloning were performed as previously described ( , ). pCRIS-PITChv2-BSD-dTAG (BRD4) was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91792 ; http://n2t.net/addgene:91792 ; RRID:Addgene_91792) and pX330-BbsI-PITCh was a gift from Peter Kaiser (Addgene plasmid # 127875 ; http://n2t.net/addgene:127875 ; RRID:Addgene_127875). .. The constructed pCRIS-PITChv2-BSD-dTAG (ZNF24) and pX330-BbsI-PITCh (ZNF24) were transfected to the sorted HAP1 cells with TransIT-LT1 (Mirus Bio, MIR 2306).



    Similar Products

    93
    Addgene inc px330 bbsi pitch addgene 127875 121
    Px330 Bbsi Pitch Addgene 127875 121, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px330+bbsi+pitch/pX330-BbsI-PITCh+(Plasmid+%23127875)/pm41904131-261-40-41
    Average 93 stars, based on 1 article reviews
    px330 bbsi pitch addgene 127875 121 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plasmid px330 pitch smg8
    Plasmid Px330 Pitch Smg8, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px330+bbsi+pitch/pX330-BbsI-PITCh+(Plasmid+%23127875)/pmc12988323-55-1-7
    Average 93 stars, based on 1 article reviews
    plasmid px330 pitch smg8 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc px330 bbsi pitch
    Px330 Bbsi Pitch, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px330+bbsi+pitch/pX330-BbsI-PITCh+(Plasmid+%23127875)/pmc12988323-55-6-7
    Average 93 stars, based on 1 article reviews
    px330 bbsi pitch - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc x330 bbsi pitch
    X330 Bbsi Pitch, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px330+bbsi+pitch/pX330-BbsI-PITCh+(Plasmid+%23127875)/pm41830328-59-6-7
    Average 93 stars, based on 1 article reviews
    x330 bbsi pitch - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc px330
    Px330, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px330+bbsi+pitch/pX330-BbsI-PITCh+(Plasmid+%23127875)/pmc12361511-420-35-36
    Average 93 stars, based on 1 article reviews
    px330 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plasmid
    Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px330+bbsi+pitch/pX330-BbsI-PITCh+(Plasmid+%23127875)/pmc12361511-13-4-2
    Average 93 stars, based on 1 article reviews
    plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc px330 bbs1 pitch
    Px330 Bbs1 Pitch, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px330+bbsi+pitch/pX330-BbsI-PITCh+(Plasmid+%23127875)/pmc12361511-13-0-2
    Average 93 stars, based on 1 article reviews
    px330 bbs1 pitch - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results